Transcript: Human NM_032849.4

Homo sapiens mesenteric estrogen dependent adipogenesis (MEDAG), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MEDAG (84935)
Length:
2294
CDS:
246..1157

Additional Resources:

NCBI RefSeq record:
NM_032849.4
NBCI Gene record:
MEDAG (84935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032849.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423620 AGAGACACCCAACCAATTTAT pLKO_005 1133 CDS 100% 15.000 21.000 N MEDAG n/a
2 TRCN0000421711 GACCAACTACTGTGATTATAA pLKO_005 536 CDS 100% 15.000 21.000 N Medag n/a
3 TRCN0000423432 GACCAACTACTGTGATTATAA pLKO_005 536 CDS 100% 15.000 21.000 N MEDAG n/a
4 TRCN0000416764 GACGTACGCGTTTCTTGTAAA pLKO_005 638 CDS 100% 13.200 18.480 N MEDAG n/a
5 TRCN0000418922 GCTCAGTAATTCCGTTGTAAA pLKO_005 872 CDS 100% 13.200 18.480 N MEDAG n/a
6 TRCN0000128072 GCAGTTTCTCTGACCGAAAGT pLKO.1 994 CDS 100% 4.950 6.930 N MEDAG n/a
7 TRCN0000128142 CTCAGTGATTGGAGAAAGTTA pLKO.1 716 CDS 100% 5.625 3.938 N MEDAG n/a
8 TRCN0000129878 GAGCAAACCAATGTTGTTCTT pLKO.1 578 CDS 100% 4.950 3.465 N MEDAG n/a
9 TRCN0000129070 GCCATATGACACCTATGAGAA pLKO.1 1712 3UTR 100% 0.000 0.000 N MEDAG n/a
10 TRCN0000128656 CATTTCCAAGTGTTCTGGAAT pLKO.1 1108 CDS 100% 0.495 0.297 N MEDAG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032849.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09243 pDONR223 99.2% 99.8% 99.6% None 175A>G n/a
2 ccsbBroad304_09243 pLX_304 0% 99.8% 99.6% V5 175A>G n/a
3 TRCN0000492051 GACTTTTCTTACCTTTTACAGAAT pLX_317 47.3% 99.8% 99.6% V5 175A>G n/a
Download CSV