Transcript: Human NM_032858.3

Homo sapiens maelstrom spermatogenic transposon silencer (MAEL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MAEL (84944)
Length:
1737
CDS:
74..1378

Additional Resources:

NCBI RefSeq record:
NM_032858.3
NBCI Gene record:
MAEL (84944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428176 ATTGCGTACTGCATCAGTAAT pLKO_005 977 CDS 100% 13.200 18.480 N MAEL n/a
2 TRCN0000017083 CCCGCTTACTAGAGAGCATTT pLKO.1 1254 CDS 100% 10.800 15.120 N MAEL n/a
3 TRCN0000422391 CTACTGCAAGTCTGATGATAG pLKO_005 712 CDS 100% 10.800 15.120 N MAEL n/a
4 TRCN0000017084 CCACGAGGATTTCGATTTCAT pLKO.1 563 CDS 100% 5.625 7.875 N MAEL n/a
5 TRCN0000432574 GACAAATGTCACTACTATAAA pLKO_005 1463 3UTR 100% 15.000 12.000 N MAEL n/a
6 TRCN0000427120 ATGTGGCCATGTGGGATTATT pLKO_005 885 CDS 100% 15.000 10.500 N MAEL n/a
7 TRCN0000017086 CTCTCATTTCAACTCTTCTAA pLKO.1 1141 CDS 100% 5.625 3.938 N MAEL n/a
8 TRCN0000017087 CAAGATTATGAGGCCAGCAAT pLKO.1 1049 CDS 100% 4.950 3.465 N MAEL n/a
9 TRCN0000017085 GAGCCCTCTAAGACTTGGATT pLKO.1 851 CDS 100% 4.950 3.465 N MAEL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04452 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04452 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465494 CAGACCACATTCCGAAGATTATTA pLX_317 31.6% 100% 100% V5 n/a
Download CSV