Transcript: Human NM_032944.4

Homo sapiens serine/threonine kinase 31 (STK31), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
STK31 (56164)
Length:
3677
CDS:
540..3530

Additional Resources:

NCBI RefSeq record:
NM_032944.4
NBCI Gene record:
STK31 (56164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146594 TTTGGAACCATGCTACAAGA pXPR_003 CGG 1499 50% 12 0.511 STK31 STK31 77375
2 BRDN0001144760 GATAGCAAGTGATCCACACT pXPR_003 GGG 1806 60% 15 0.3861 STK31 STK31 77376
3 BRDN0001144860 GTGACTTGCCTGATCAAACT pXPR_003 GGG 406 14% 6 0.3262 STK31 STK31 77374
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368917 CAAGATTTATGGTGGATTATT pLKO_005 716 CDS 100% 15.000 21.000 N STK31 n/a
2 TRCN0000364397 TACACTCTGAAGACCTATATA pLKO_005 1530 CDS 100% 15.000 12.000 N STK31 n/a
3 TRCN0000003277 GCTATCCATTAAGAAGACATT pLKO.1 2357 CDS 100% 4.950 3.960 N STK31 n/a
4 TRCN0000364395 ATAACTCAGCTGCGCAATAAT pLKO_005 2481 CDS 100% 15.000 10.500 N STK31 n/a
5 TRCN0000364396 ATACTGAATACACCCTATATA pLKO_005 3427 CDS 100% 15.000 10.500 N STK31 n/a
6 TRCN0000194908 CAAGCCAACATGCCTTTAAAT pLKO.1 2931 CDS 100% 15.000 10.500 N STK31 n/a
7 TRCN0000196648 GCAGGCAATCTTATAACATTT pLKO.1 1287 CDS 100% 13.200 9.240 N STK31 n/a
8 TRCN0000368919 TGGTACGTTCTGAGGTTAATG pLKO_005 2704 CDS 100% 13.200 9.240 N STK31 n/a
9 TRCN0000368918 TTTGGGCCCAGAGTATCAATA pLKO_005 610 CDS 100% 13.200 9.240 N STK31 n/a
10 TRCN0000196555 GACTTTAATTTAGGGTCTAAC pLKO.1 1332 CDS 100% 10.800 7.560 N STK31 n/a
11 TRCN0000003276 CCTCTGTAGCTTGATATGTTA pLKO.1 3320 CDS 100% 5.625 3.938 N STK31 n/a
12 TRCN0000003278 CGGAGAACTTGGATAAATGTA pLKO.1 3469 CDS 100% 5.625 3.938 N STK31 n/a
13 TRCN0000195545 CCACAGTACAAGCTAAGTACA pLKO.1 2269 CDS 100% 4.950 3.465 N STK31 n/a
14 TRCN0000003275 GCAGGATTTGTCAGTCTCTTT pLKO.1 1883 CDS 100% 4.950 3.465 N STK31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488677 CTAGCTAACCTGACGCCCCCGGGA pLX_317 11.5% 97.7% 97.6% V5 (not translated due to prior stop codon) 0_1ins69;144G>C n/a
Download CSV