Transcript: Human NM_033017.4

Homo sapiens tripartite motif containing 4 (TRIM4), transcript variant alpha, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TRIM4 (89122)
Length:
3392
CDS:
130..1632

Additional Resources:

NCBI RefSeq record:
NM_033017.4
NBCI Gene record:
TRIM4 (89122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033017.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034031 GCTGAATGAGAACACGTTAAA pLKO.1 822 CDS 100% 13.200 10.560 N TRIM4 n/a
2 TRCN0000229380 GCTGAATGAGAACACGTTAAA pLKO_005 822 CDS 100% 13.200 10.560 N TRIM4 n/a
3 TRCN0000229381 GTGGGCATCTGGGCGATTTAT pLKO_005 1369 CDS 100% 15.000 10.500 N TRIM4 n/a
4 TRCN0000229383 AGTTATGCACTACTAACATTT pLKO_005 2829 3UTR 100% 13.200 9.240 N TRIM4 n/a
5 TRCN0000034032 GCGATTCCAAGTGGCTGTAAA pLKO.1 1038 CDS 100% 13.200 9.240 N TRIM4 n/a
6 TRCN0000034033 CACCAGTGACTGATAGGAAAT pLKO.1 1610 CDS 100% 10.800 7.560 N TRIM4 n/a
7 TRCN0000229382 CATTAGCATCTTTAGTCATTC pLKO_005 1589 CDS 100% 10.800 7.560 N TRIM4 n/a
8 TRCN0000218921 TTCTTAAGTCTCAGCGTAATC pLKO_005 608 CDS 100% 10.800 7.560 N TRIM4 n/a
9 TRCN0000034029 CGCTTCATTGAAGAAGCTCAT pLKO.1 858 CDS 100% 0.405 0.284 N TRIM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033017.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12920 pDONR223 100% 57.7% 56% None (many diffs) n/a
2 ccsbBroad304_12920 pLX_304 0% 57.7% 56% V5 (many diffs) n/a
3 TRCN0000478998 AGTGAAAAATCGTGCTCGTGCGTG pLX_317 56.8% 57.7% 56% V5 (many diffs) n/a
Download CSV