Transcript: Human NM_033064.5

Homo sapiens ATCAY kinesin light chain interacting caytaxin (ATCAY), mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
ATCAY (85300)
Length:
4971
CDS:
366..1481

Additional Resources:

NCBI RefSeq record:
NM_033064.5
NBCI Gene record:
ATCAY (85300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060107 GTCCTGCAATACGAAGAGGAA pLKO.1 1323 CDS 100% 2.640 3.696 N ATCAY n/a
2 TRCN0000060104 CCCTTTCATCAGCGTCAAGTT pLKO.1 1220 CDS 100% 4.950 3.465 N ATCAY n/a
3 TRCN0000060106 CTACCACTACATCATGGAGAA pLKO.1 983 CDS 100% 4.050 2.835 N ATCAY n/a
4 TRCN0000060105 GAGATCAACATTTCTCTGGAT pLKO.1 564 CDS 100% 2.640 1.848 N ATCAY n/a
5 TRCN0000060103 GCTCAGAAACTGGCTCTGAAA pLKO.1 2336 3UTR 100% 0.495 0.347 N ATCAY n/a
6 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3847 3UTR 100% 4.950 2.475 Y NPHS1 n/a
7 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 2706 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04475 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04475 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472006 TAGTACCAAAAGCTTAACAGCGTT pLX_317 36.8% 100% 100% V5 n/a
Download CSV