Transcript: Human NM_033101.4

Homo sapiens galectin 12 (LGALS12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LGALS12 (85329)
Length:
1699
CDS:
376..1320

Additional Resources:

NCBI RefSeq record:
NM_033101.4
NBCI Gene record:
LGALS12 (85329)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033101.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057373 GCTGGGTATATTTGGTGACAT pLKO.1 813 CDS 100% 4.950 6.930 N LGALS12 n/a
2 TRCN0000057375 GTTCCTTATGTCACGACGATT pLKO.1 448 CDS 100% 4.950 6.930 N LGALS12 n/a
3 TRCN0000429072 TCCTCTTTCTCTTCGGGAATG pLKO_005 716 CDS 100% 6.000 4.200 N LGALS12 n/a
4 TRCN0000057374 CCAATTCCTGACAGCTTCATT pLKO.1 400 CDS 100% 5.625 3.938 N LGALS12 n/a
5 TRCN0000057377 CCTGGGCAGGTCATCATAGTA pLKO.1 973 CDS 100% 5.625 3.938 N LGALS12 n/a
6 TRCN0000057376 CTGTCATGTCACCTGGAGAAA pLKO.1 371 5UTR 100% 4.950 3.465 N LGALS12 n/a
7 TRCN0000417914 GTCACGAGACTGAGTCTACAG pLKO_005 1444 3UTR 100% 4.050 2.835 N LGALS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033101.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04477 pDONR223 100% 93.4% 93.4% None 0_1ins66 n/a
2 ccsbBroad304_04477 pLX_304 0% 93.4% 93.4% V5 0_1ins66 n/a
3 TRCN0000471699 CCCGAAATCCCCCGATGCCCATTT pLX_317 36.4% 93.4% 93.4% V5 0_1ins66 n/a
Download CSV