Transcript: Human NM_033102.3

Homo sapiens solute carrier family 45 member 3 (SLC45A3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC45A3 (85414)
Length:
3391
CDS:
347..2008

Additional Resources:

NCBI RefSeq record:
NM_033102.3
NBCI Gene record:
SLC45A3 (85414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116216 CGCCATTTACTTTGCTACACA pLKO.1 1945 CDS 100% 3.000 4.200 N SLC45A3 n/a
2 TRCN0000329432 CAGGTGTTCCTGCCCAAATAC pLKO_005 1568 CDS 100% 13.200 9.240 N Slc45a3 n/a
3 TRCN0000116213 CCAGTCTGTCACTGCCTATAT pLKO.1 1897 CDS 100% 13.200 9.240 N SLC45A3 n/a
4 TRCN0000416795 GGGTTTCAGTCTGGACTTATA pLKO_005 2242 3UTR 100% 13.200 9.240 N SLC45A3 n/a
5 TRCN0000116215 CTACTCTGTCTATGCCTTCAT pLKO.1 826 CDS 100% 4.950 3.465 N SLC45A3 n/a
6 TRCN0000116212 GCTTCGTTTAATGTAGCTCTT pLKO.1 2434 3UTR 100% 4.050 2.835 N SLC45A3 n/a
7 TRCN0000438042 TGGATGGCACTCATGACCTTC pLKO_005 1190 CDS 100% 4.050 2.835 N SLC45A3 n/a
8 TRCN0000413206 CTCCATGGGATTTGAACATAT pLKO_005 2483 3UTR 100% 13.200 7.920 N SLC45A3 n/a
9 TRCN0000116214 CTGGTCAACCTGCTAACCTTT pLKO.1 404 CDS 100% 4.950 2.970 N SLC45A3 n/a
10 TRCN0000125088 GAGACACTATGATGAAGGCAT pLKO.1 1288 CDS 100% 2.640 2.112 N Slc45a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09263 pDONR223 100% 99.9% 100% None 927G>T n/a
2 ccsbBroad304_09263 pLX_304 0% 99.9% 100% V5 927G>T n/a
3 TRCN0000480458 TTAGCATACGCAGACGGGTGTTGC pLX_317 20.5% 99.9% 100% V5 927G>T n/a
Download CSV