Transcript: Human NM_033121.2

Homo sapiens ankyrin repeat domain 13A (ANKRD13A), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ANKRD13A (88455)
Length:
4241
CDS:
260..2032

Additional Resources:

NCBI RefSeq record:
NM_033121.2
NBCI Gene record:
ANKRD13A (88455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167995 CGAGTCTTACTCCGACATAAA pLKO.1 431 CDS 100% 13.200 18.480 N ANKRD13A n/a
2 TRCN0000431140 GAGCATCATCACTTTCCATTA pLKO_005 2267 3UTR 100% 10.800 8.640 N ANKRD13A n/a
3 TRCN0000167684 GCACGGATTACATTTGGAAAT pLKO.1 1520 CDS 100% 10.800 8.640 N ANKRD13A n/a
4 TRCN0000168369 GCCGAAGAATCTGTATCTCAA pLKO.1 1559 CDS 100% 4.950 3.960 N ANKRD13A n/a
5 TRCN0000420513 CATTCCCATCATTGACCTAAT pLKO_005 1393 CDS 100% 10.800 7.560 N ANKRD13A n/a
6 TRCN0000167374 GATATCACATTGCTGGGATTT pLKO.1 731 CDS 100% 10.800 7.560 N ANKRD13A n/a
7 TRCN0000168122 GCTGACGATTAGAACACAGAA pLKO.1 1315 CDS 100% 4.950 3.465 N ANKRD13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12919 pDONR223 100% 42.4% 42.2% None (many diffs) n/a
2 ccsbBroad304_12919 pLX_304 0% 42.4% 42.2% V5 (many diffs) n/a
3 TRCN0000468810 TCGCTGGAGGCTTTATGGGGCCGT pLX_317 50.8% 42.4% 42.2% V5 (many diffs) n/a
Download CSV