Construct: ORF TRCN0000468810
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001618.1_s317c1
- Derived from:
- ccsbBroadEn_12919
- DNA Barcode:
- TCGCTGGAGGCTTTATGGGGCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANKRD13A (88455)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468810
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_017020162.1 | 53.6% | 53.5% | (many diffs) |
| 2 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_011538938.2 | 53.4% | 53.3% | (many diffs) |
| 3 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_017020158.1 | 45.3% | 45.1% | (many diffs) |
| 4 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_017020157.1 | 45.2% | 45% | (many diffs) |
| 5 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_005253982.3 | 42.4% | 42.2% | (many diffs) |
| 6 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | NM_033121.2 | 42.4% | 42.2% | (many diffs) |
| 7 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_005253981.3 | 42.4% | 42.2% | (many diffs) |
| 8 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_005253980.3 | 42.3% | 42.1% | (many diffs) |
| 9 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XR_944812.3 | 38.8% | (many diffs) | |
| 10 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_011538937.1 | 34.3% | 34% | (many diffs) |
| 11 | human | 88455 | ANKRD13A | ankyrin repeat domain 13A | XM_005253984.1 | 27.5% | 27.2% | (many diffs) |
| 12 | mouse | 68420 | Ankrd13a | ankyrin repeat domain 13a | NM_026718.2 | 37.9% | 39.2% | (many diffs) |
| 13 | mouse | 68420 | Ankrd13a | ankyrin repeat domain 13a | XM_006530454.3 | 37.9% | 39.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ctcggcctgc gacgcgggcg accactaccc cctgcacctc ctagtctgga 121 aaaacgacta ccggcagctc gagaaggagc tgcagggcca gaatgtggag gctgtggacc 181 cacgaggtcg aacattattg catcttgctg tttccttggg acatttggaa tctgctcgag 241 tcttactccg acataaagca gatgtgacaa aagaaaatcg ccagggatgg acagttttac 301 atgaggctgt gagcactggc gatcctgaga tggtgtacac agttctccaa catcgagact 361 accacaacac atccatggcc cttgagggag ttcctgagct gctccaaaaa attctcgagg 421 ctccggattt ctatgtgcag atgaaatggg aATTCACCAG CTGGGTGCCC TTGGTTTCTA 481 GAATATGCCC GAATGATGTC TGTCGCATCT GGAAAAGTGG TGCCAAACTG CGCGTCGATA 541 TCACATTGCT GGGATTTGAA AACATGAGCT GGATAAGAGG GAGGCGTAGT TTTATATTTA 601 AGGGAGAAGA CAACTGGGCG GAGTTAATGG AAGTCAACCA TGATGACAAA GTGGTCACCA 661 CCGAACGCTT CGACCTTTCC CAAGAAATGG AGCGCCTCAC TCTGGACTTG ATGAAGCCAA 721 AAAGCAGGGA AGTTGAGCGG CGGCTCACAA GCCCTGTCAT TAACACCAGC CTCGATACTA 781 AAAATATTGC TTTTGAAAGG GTTTTCAGAG TTCTCAAGCT AACTCTTTTG CAACTGACAG 841 TGTGTAGCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATCGCTG GAGGCTTTAT GGGGCCGTAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt