Transcript: Human NM_033157.4

Homo sapiens caldesmon 1 (CALD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CALD1 (800)
Length:
4321
CDS:
246..1937

Additional Resources:

NCBI RefSeq record:
NM_033157.4
NBCI Gene record:
CALD1 (800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033157.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157180 GCCGCATCAATGAATGGCTAA pLKO.1 1786 CDS 100% 4.050 5.670 N CALD1 n/a
2 TRCN0000330608 GCCGCATCAATGAATGGCTAA pLKO_005 1786 CDS 100% 4.050 5.670 N CALD1 n/a
3 TRCN0000330609 CTCAGTTGTAGAGGGCTAATT pLKO_005 1979 3UTR 100% 13.200 10.560 N CALD1 n/a
4 TRCN0000157319 CCAGAAGATGGCTTGTCAGAT pLKO.1 1425 CDS 100% 4.950 3.465 N CALD1 n/a
5 TRCN0000330607 CCAGAAGATGGCTTGTCAGAT pLKO_005 1425 CDS 100% 4.950 3.465 N CALD1 n/a
6 TRCN0000155691 CGCCAAGAAAGATACGAGATA pLKO.1 711 CDS 100% 4.950 3.465 N CALD1 n/a
7 TRCN0000330606 CGCCAAGAAAGATACGAGATA pLKO_005 711 CDS 100% 4.950 3.465 N CALD1 n/a
8 TRCN0000155194 GAAGAGTTCGAGAAGCTCAAA pLKO.1 1203 CDS 100% 4.950 3.465 N CALD1 n/a
9 TRCN0000155917 CATGGATCGAAAGAAGGGATT pLKO.1 1001 CDS 100% 4.050 2.835 N CALD1 n/a
10 TRCN0000157861 CGAAGCAGAAAGAATCGCCTA pLKO.1 305 CDS 100% 2.160 1.512 N CALD1 n/a
11 TRCN0000108680 GCCTGTTTCTAAAGAAACCAT pLKO.1 2148 3UTR 100% 0.300 0.210 N Cald1 n/a
12 TRCN0000303123 GCCTGTTTCTAAAGAAACCAT pLKO_005 2148 3UTR 100% 0.300 0.210 N Cald1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033157.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00206 pDONR223 100% 95.2% 95.2% None 620_697del;1290_1291insAGC n/a
2 ccsbBroad304_00206 pLX_304 0% 95.2% 95.2% V5 620_697del;1290_1291insAGC n/a
3 TRCN0000469974 CCGTTCGTCACCGTGCTACGTCCA pLX_317 29% 95.2% 95.2% V5 620_697del;1290_1291insAGC n/a
Download CSV