Transcript: Human NM_033208.4

Homo sapiens tigger transposable element derived 7 (TIGD7), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TIGD7 (91151)
Length:
3421
CDS:
1615..3264

Additional Resources:

NCBI RefSeq record:
NM_033208.4
NBCI Gene record:
TIGD7 (91151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152486 CCATAGCAAATGCATGGGAAA pLKO.1 2795 CDS 100% 4.050 5.670 N TIGD7 n/a
2 TRCN0000153907 CAAACGGCTGTATAGATGGAA pLKO.1 2628 CDS 100% 3.000 4.200 N TIGD7 n/a
3 TRCN0000417365 TGTTCCTGAGGTCCGACATTT pLKO_005 2424 CDS 100% 13.200 10.560 N TIGD7 n/a
4 TRCN0000153246 GTAGAATTGAAGCTGGACGAT pLKO.1 1673 CDS 100% 2.640 2.112 N TIGD7 n/a
5 TRCN0000152929 CACAAGTACATTGCCTGTGAT pLKO.1 2337 CDS 100% 4.950 3.465 N TIGD7 n/a
6 TRCN0000156774 GCAAATGCAGACGGAACTCAT pLKO.1 2260 CDS 100% 4.950 3.465 N TIGD7 n/a
7 TRCN0000157780 CAGAGAGATTTGCACGGTGTT pLKO.1 1934 CDS 100% 4.050 2.835 N TIGD7 n/a
8 TRCN0000152633 GCATTGTTACTTCTGGACAGT pLKO.1 2485 CDS 100% 2.640 1.848 N TIGD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04538 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04538 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477448 GCTGCAGCCTCTTAGGATTATCGA pLX_317 29.9% 100% 100% V5 n/a
Download CSV