Transcript: Human NM_033277.2

Homo sapiens lacritin (LACRT), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LACRT (90070)
Length:
552
CDS:
55..471

Additional Resources:

NCBI RefSeq record:
NM_033277.2
NBCI Gene record:
LACRT (90070)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243942 CTGGGACCTCTAAGCCTAATG pLKO_005 158 CDS 100% 10.800 15.120 N LACRT n/a
2 TRCN0000172277 CTCAAGCAGGCAGGAACTAAA pLKO.1 279 CDS 100% 13.200 9.240 N LACRT n/a
3 TRCN0000243944 CTCAAGCAGGCAGGAACTAAA pLKO_005 279 CDS 100% 13.200 9.240 N LACRT n/a
4 TRCN0000243945 CTGAAATCCATAGTGGAGAAA pLKO_005 304 CDS 100% 4.950 3.465 N LACRT n/a
5 TRCN0000243946 GCCCTGGTCTATGCTGAAGAT pLKO_005 97 CDS 100% 4.950 3.465 N LACRT n/a
6 TRCN0000167856 GTATCTTACTAACAGAACAAG pLKO.1 326 CDS 100% 4.950 3.465 N LACRT n/a
7 TRCN0000243943 GAGATCTCAGGTCCAGCAGAA pLKO_005 181 CDS 100% 4.050 2.835 N LACRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16055 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16055 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466916 TAAGGGTGCGCGTCTAAAGGAAGA pLX_317 81.5% 100% 100% V5 n/a
4 ccsbBroadEn_09285 pDONR223 100% 99.7% 100% None 219G>A n/a
5 ccsbBroad304_09285 pLX_304 0% 99.7% 100% V5 219G>A n/a
6 TRCN0000469668 GCTGACCAGAAACTCTGACTATTT pLX_317 82% 99.7% 100% V5 219G>A n/a
Download CSV