Transcript: Human NM_033316.4

Homo sapiens melanotransferrin (MELTF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MELTF (4241)
Length:
1676
CDS:
116..1024

Additional Resources:

NCBI RefSeq record:
NM_033316.4
NBCI Gene record:
MELTF (4241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033316.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047101 CAAAGCTGTCAGCGACTATTT pLKO.1 598 CDS 100% 13.200 18.480 N MELTF n/a
2 TRCN0000428601 GGGCGAAGTGTACGATCAAGA pLKO_005 400 CDS 100% 4.950 6.930 N MELTF n/a
3 TRCN0000047099 GTGACCATTGACACCCTGAAA pLKO.1 470 CDS 100% 4.950 3.465 N MELTF n/a
4 TRCN0000420629 TGTGAAGCACAGCACGGTACT pLKO_005 793 CDS 100% 4.050 2.835 N MELTF n/a
5 TRCN0000047102 GCAGCACAAGTGCGGCAACAT pLKO.1 211 CDS 100% 1.650 1.155 N MELTF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033316.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01004 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01004 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469761 GCTGCGCTCAATACTTTACAAGTG pLX_317 39.3% 100% 100% V5 n/a
Download CSV