Transcript: Human NM_033343.4

Homo sapiens LIM homeobox 4 (LHX4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LHX4 (89884)
Length:
5844
CDS:
267..1439

Additional Resources:

NCBI RefSeq record:
NM_033343.4
NBCI Gene record:
LHX4 (89884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419923 ATGGAAGTCCTCCGCTGATTC pLKO_005 1557 3UTR 100% 10.800 15.120 N LHX4 n/a
2 TRCN0000413112 GTGTAGGCTATCCCGACTTTC pLKO_005 1369 CDS 100% 10.800 15.120 N LHX4 n/a
3 TRCN0000415914 GTGTGCCGATGCAACAGATTC pLKO_005 328 CDS 100% 10.800 8.640 N Lhx4 n/a
4 TRCN0000017490 GCAGTTCTATAAGAGCGTCAA pLKO.1 941 CDS 100% 4.050 3.240 N LHX4 n/a
5 TRCN0000017489 GACAGTAATTTGGGCATCATT pLKO.1 1269 CDS 100% 5.625 3.938 N LHX4 n/a
6 TRCN0000070554 CTTTGCTCAATGGGCTGGATT pLKO.1 1240 CDS 100% 4.950 3.465 N Lhx4 n/a
7 TRCN0000017491 GAGGATCAAATTCTCTCAGAA pLKO.1 1044 CDS 100% 4.950 3.465 N LHX4 n/a
8 TRCN0000017492 GCACTGCTTTGCTTGCATCAT pLKO.1 602 CDS 100% 4.950 3.465 N LHX4 n/a
9 TRCN0000017488 CCTGGACAAGTTCATCCTGAA pLKO.1 377 CDS 100% 4.050 2.430 N LHX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04496 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04496 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478681 CCCAAGCTATTCGCCCATCTAACG pLX_317 36.3% 100% 100% V5 n/a
Download CSV