Transcript: Human NM_033625.3

Homo sapiens ribosomal protein L34 (RPL34), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RPL34 (6164)
Length:
1006
CDS:
133..486

Additional Resources:

NCBI RefSeq record:
NM_033625.3
NBCI Gene record:
RPL34 (6164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262348 GTTCGTGCTGTAAGACCTAAA pLKO_005 298 CDS 100% 10.800 15.120 N RPL34P34 n/a
2 TRCN0000077923 CCCTAGATACTACTCAAGTTA pLKO.1 730 3UTR 100% 5.625 7.875 N RPL34 n/a
3 TRCN0000077927 GACCTAAAGTTCTTATGAGAT pLKO.1 311 CDS 100% 4.950 6.930 N RPL34 n/a
4 TRCN0000289188 GACCTAAAGTTCTTATGAGAT pLKO_005 311 CDS 100% 4.950 6.930 N RPL34 n/a
5 TRCN0000296171 TGCTAAATGTGTTCGTGACAG pLKO_005 381 CDS 100% 4.050 3.240 N RPL34 n/a
6 TRCN0000308093 AGCGTGCTTTCCTTATCGAGG pLKO_005 407 CDS 100% 2.160 1.728 N RPL34 n/a
7 TRCN0000310261 CCCAGAGAGCTGGAGGTTAAA pLKO_005 695 3UTR 100% 13.200 9.240 N RPL34 n/a
8 TRCN0000262350 ATACCAAGAAGGTTGGGAAAG pLKO_005 233 CDS 100% 6.000 4.200 N RPL34P34 n/a
9 TRCN0000077926 CGTGCTGTAAGACCTAAAGTT pLKO.1 301 CDS 100% 5.625 3.938 N RPL34 n/a
10 TRCN0000077924 CCCTGGTAATAGAATTGTTTA pLKO.1 207 CDS 100% 13.200 7.920 N RPL34 n/a
11 TRCN0000262349 CCTGGTAATAGAATTGTTTAC pLKO_005 208 CDS 100% 10.800 6.480 N RPL34P34 n/a
12 TRCN0000077925 AGCACAGAGTCAGAAAGCTAA pLKO.1 462 CDS 100% 4.950 2.970 N RPL34 n/a
13 TRCN0000289189 AGCACAGAGTCAGAAAGCTAA pLKO_005 462 CDS 100% 4.950 2.970 N RPL34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01435 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465339 GCAAGTGGATTTAGGATTTTGTCT pLX_317 64.1% 100% 100% V5 n/a
Download CSV