Transcript: Human NM_052828.3

Homo sapiens tripartite motif containing 10 (TRIM10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TRIM10 (10107)
Length:
3286
CDS:
354..1541

Additional Resources:

NCBI RefSeq record:
NM_052828.3
NBCI Gene record:
TRIM10 (10107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235418 GAATTGAGACTACCGTAATTG pLKO_005 2386 3UTR 100% 13.200 18.480 N TRIM10 n/a
2 TRCN0000007637 CGGACATCAGAAGCACTCTAA pLKO.1 1108 CDS 100% 4.950 6.930 N TRIM10 n/a
3 TRCN0000235419 ACATCAGAAGCACTCTAATAA pLKO_005 1111 CDS 100% 15.000 10.500 N TRIM10 n/a
4 TRCN0000235415 GAGCTCAGTTCTCCTACAAAT pLKO_005 1345 CDS 100% 13.200 9.240 N TRIM10 n/a
5 TRCN0000235416 TATGCTTTGAGTTGGACTATG pLKO_005 1255 CDS 100% 10.800 7.560 N TRIM10 n/a
6 TRCN0000007636 GCTAACGTGGTGGAGAACATT pLKO.1 579 CDS 100% 5.625 3.938 N TRIM10 n/a
7 TRCN0000007638 CTATGCTTTGAGTTGGACTAT pLKO.1 1254 CDS 100% 4.950 3.465 N TRIM10 n/a
8 TRCN0000007635 GCACTCTAATAAGATGTGAAA pLKO.1 1120 CDS 100% 4.950 3.465 N TRIM10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07553 pDONR223 100% 99.9% 100% None 1038A>G n/a
2 ccsbBroad304_07553 pLX_304 0% 99.9% 100% V5 1038A>G n/a
3 TRCN0000477889 AACTGGTTGCTCAGGGGAGCTTCA pLX_317 23.7% 99.9% 100% V5 1038A>G n/a
Download CSV