Construct: ORF TRCN0000477889
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014148.1_s317c1
- Derived from:
- ccsbBroadEn_07553
- DNA Barcode:
- AACTGGTTGCTCAGGGGAGCTTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRIM10 (10107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477889
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10107 | TRIM10 | tripartite motif containing 10 | NM_052828.3 | 99.9% | 100% | 1038A>G |
| 2 | human | 10107 | TRIM10 | tripartite motif containing 10 | XM_011514225.1 | 94.2% | 92% | (many diffs) |
| 3 | human | 10107 | TRIM10 | tripartite motif containing 10 | NM_006778.4 | 80.1% | 76.3% | (many diffs) |
| 4 | human | 10107 | TRIM10 | tripartite motif containing 10 | XM_011514221.1 | 76.1% | 70.6% | (many diffs) |
| 5 | human | 10107 | TRIM10 | tripartite motif containing 10 | XM_011514222.2 | 76.1% | 70.6% | (many diffs) |
| 6 | human | 10107 | TRIM10 | tripartite motif containing 10 | XM_011514223.2 | 76.1% | 70.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1254
- ORF length:
- 1185
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcctctgct gcctctgtga ccagcctggc agatgaagtc aactgcccca 121 tctgtcaggg taccctgagg gagccggtca ctatcgactg cggccacaac ttctgccggg 181 cctgccttac ccgctactgt gagataccag gcccagacct ggaggagtcc cctacttgcc 241 cactctgcaa agaacccttc cgtcctggga gcttccggcc caactggcag ctggctaacg 301 tggtggagaa cattgagcgc ctccagctgg tgtccacact gggtttggga gaggaggatg 361 tctgccaaga gcacggagag aagatctact tcttctgtga ggatgatgag atgcagttgt 421 gcgtggtgtg ccgggaggct ggggagcacg ctacccacac catgcgcttc ctggaggatg 481 cagcggctcc ctatagggaa caaatccata agtgtcttaa atgtctaaga aaagagagag 541 aggagattca agaaatccag tcaagagaaa ataaaaggat gcaagtcctc ctgactcagg 601 tgtccaccaa gagacaacag gtgatttctg agttcgcaca cctgaggaag tttctagagg 661 aacagcagag catcctctta gcacaattgg agagccagga tggggacatc ttgaggcaac 721 gggatgaatt tgatttgctg gttgctgggg agatctgccg gtttagtgct cttattgaag 781 aactggagga gaagaatgag aggccagcaa gggagctcct gacggacatc agaagcactc 841 taataagatg tgaaaccaga aagtgccgga aaccggtggc tgtgtcgcca gagctgggcc 901 agaggattcg ggactttccc cagcaggccc tcccgctgca gagggagatg aagatgtttc 961 tggaaaaact atgctttGAG TTGGACTATG AGCCAGCTCA CATTTCTCTA GACCCTCAGA 1021 CTTCCCACCC CAAGCTCCTC TTGTCCGAGG ACCACCAGCG AGCTCAGTTC TCCTACAAAT 1081 GGCAGAACTC ACCAGACAAC CCCCAGCGTT TTGACCGGGC CACCTGTGTT CTGGCCCACA 1141 CTGGCATCAC AGGGGGGAGA CACACGTGGG TGTGGATGGC CAGGGTACCT GGGGACTCAG 1201 GCTGCTGCCA GTTCTGCTCA CCACCATCCG TGCTTGGCAC AGAAGTAGCT GCATTGCCAA 1261 CTTCCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1321 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1381 TATCTTGTGG AAAGGACGAA ACTGGTTGCT CAGGGGAGCT TCAACGCGTT AAGTCgacaa 1441 tcaacctctg gattacaaaa tttgtgaaag att