Transcript: Human NM_052838.6

Homo sapiens septin 1 (SEPTIN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN1 (1731)
Length:
1555
CDS:
138..1256

Additional Resources:

NCBI RefSeq record:
NM_052838.6
NBCI Gene record:
SEPTIN1 (1731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052838.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156806 GAACCCACATCACTGCGATTT pLKO.1 917 CDS 100% 10.800 8.640 N SEPTIN1 n/a
2 TRCN0000156544 GTGAAAGTGAAGCTGACCCTT pLKO.1 393 CDS 100% 2.640 2.112 N SEPTIN1 n/a
3 TRCN0000154137 CGAATGTGACTCTGATGAAGA pLKO.1 758 CDS 100% 4.950 3.465 N SEPTIN1 n/a
4 TRCN0000152987 GATGAAGGAAAGCATCCCTTT pLKO.1 806 CDS 100% 4.050 2.835 N SEPTIN1 n/a
5 TRCN0000152609 GAGCAATTTGAGCAGTACCTT pLKO.1 486 CDS 100% 3.000 2.100 N SEPTIN1 n/a
6 TRCN0000152570 GTTTGACTTCACGCTAATGGT pLKO.1 221 CDS 100% 3.000 2.100 N SEPTIN1 n/a
7 TRCN0000156444 CTCACCAACCTCTATGAGGAT pLKO.1 291 CDS 100% 2.640 1.848 N SEPTIN1 n/a
8 TRCN0000157464 GCAAGAGATGCTGGAGAAGAT pLKO.1 1181 CDS 100% 4.950 2.970 N SEPTIN1 n/a
9 TRCN0000157926 CCTCTACTTCATCTCACCCTT pLKO.1 563 CDS 100% 2.640 1.584 N SEPTIN1 n/a
10 TRCN0000101791 CTCTACTTCATCTCACCCTTT pLKO.1 564 CDS 100% 4.050 2.430 N Sept1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052838.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00444 pDONR223 100% 98.6% 98.6% None 1_15del n/a
2 ccsbBroad304_00444 pLX_304 0% 98.6% 98.6% V5 1_15del n/a
3 TRCN0000467119 CCTCTCCCACGGCCTAATGCTCAA pLX_317 34.1% 98.6% 98.6% V5 1_15del n/a
Download CSV