Transcript: Human NM_052848.3

Homo sapiens coiled-coil domain containing 97 (CCDC97), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CCDC97 (90324)
Length:
3329
CDS:
140..1171

Additional Resources:

NCBI RefSeq record:
NM_052848.3
NBCI Gene record:
CCDC97 (90324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162895 GAGGAGGAGAGGTACTTTGAT pLKO.1 1103 CDS 100% 5.625 3.938 N CCDC97 n/a
2 TRCN0000163044 GATGAGGAGGAGAGGTACTTT pLKO.1 1100 CDS 100% 5.625 3.938 N CCDC97 n/a
3 TRCN0000161898 GACTTTGACTACAGCACAGTA pLKO.1 1037 CDS 100% 4.950 3.465 N CCDC97 n/a
4 TRCN0000136295 GTACTTCAGTGATGAGCAGAT pLKO.1 649 CDS 100% 4.050 2.835 N CCDC97 n/a
5 TRCN0000164386 CCTCCTTGCTTCTGTTAGGTT pLKO.1 1712 3UTR 100% 3.000 2.100 N CCDC97 n/a
6 TRCN0000161249 GAGAGGTACTTTGATGAGGAA pLKO.1 1109 CDS 100% 2.640 1.848 N CCDC97 n/a
7 TRCN0000136744 GATGAGGAAGAACCTGAGGAT pLKO.1 1121 CDS 100% 2.640 1.848 N CCDC97 n/a
8 TRCN0000164285 CCCTGCTATATGAGCAGTACA pLKO.1 684 CDS 100% 0.495 0.347 N CCDC97 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04511 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04511 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492281 ATCGGACATTCGTAGATGATTCCG pLX_317 19.2% 100% 100% V5 n/a
Download CSV