Construct: ORF TRCN0000492281
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005311.2_s317c1
- Derived from:
- ccsbBroadEn_04511
- DNA Barcode:
- ATCGGACATTCGTAGATGATTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCDC97 (90324)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492281
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90324 | CCDC97 | coiled-coil domain containi... | NM_052848.3 | 100% | 100% | |
| 2 | human | 90324 | CCDC97 | coiled-coil domain containi... | NM_001346100.2 | 81% | 81% | 0_1ins195 |
| 3 | human | 90324 | CCDC97 | coiled-coil domain containi... | XM_017027442.1 | 76.4% | 68.3% | (many diffs) |
| 4 | mouse | 52132 | Ccdc97 | coiled-coil domain containi... | XM_006540173.3 | 68.3% | 72.3% | (many diffs) |
| 5 | mouse | 52132 | Ccdc97 | coiled-coil domain containi... | XM_006540174.3 | 68.3% | 72.3% | (many diffs) |
| 6 | mouse | 52132 | Ccdc97 | coiled-coil domain containi... | XM_011250626.2 | 68.3% | 72.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggccgtggcg acggcgacgg cggcgaagga acccgataag ggctgcatag 121 agcctggacc tgggcactgg ggtgagctga gccggacacc agtcccatct aaaccccagg 181 acaaagtgga agcagctgag gcaacaccag tggccctgga cagtgacacc tccggggctg 241 aaaatgcagc agtgagtgct atgctgcacg ctgtagccgc cagccgcctg cctgtttgca 301 gccagcagca gggtgaaccc gacttgacag agcatgagaa agtggccatc ctggcccagc 361 tgtaccacga gaagccactg gtgttcctgg agcgcttccg cacaggcctc cgtgaggagc 421 atctggcctg ctttggccac gtgcgtggcg accaccgtgc agacttctac tgtgctgagg 481 tggcccggca gggcactgcc cggccccgca ccctgcgtac ccgcctgcgt aaccggcgct 541 atgctgccct gcgagagctg atccaagggg gcgagtactt cagtgatgag cagatgcggt 601 tccgggcccc cctgctatat gagcagtaca tcgggcagta tctcacccag gaggagctca 661 gtgcccgcac cccaacccac cagcccccca agcccgggtc ccccgggaga cctgcttgcc 721 cgctctccaa cttgctgctc cagtcctacg aggagcggga gctacagcag cgtctgctcc 781 aacagcagga ggaggaggag gcctgcttgg aggaagagga agaggaggag gacagtgacg 841 aggaagacca gaggtcaggc aaggactcgg aggcctgggt tcccgactcg gaggagaggc 901 tgaTCCTGCG AGAGGAGTTC ACCAGCCGCA TGCACCAGCG CTTCCTAGAT GGCAAGGACG 961 GGGACTTTGA CTACAGCACA GTAGACGACA ACCCCGACTT CGACAACCTC GACATCGTGG 1021 CACGGGATGA GGAGGAGAGG TACTTTGATG AGGAAGAACC TGAGGATGCG CCCAGCCCAG 1081 AGCTGGATGG GGACTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1141 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1201 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATCGGACATT CGTAGATGAT 1261 TCCGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt