Transcript: Human NM_052905.4

Homo sapiens formin like 2 (FMNL2), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FMNL2 (114793)
Length:
5630
CDS:
431..3709

Additional Resources:

NCBI RefSeq record:
NM_052905.4
NBCI Gene record:
FMNL2 (114793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052905.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364657 CATTCTGCACTGCGATATAAT pLKO_005 1013 CDS 100% 15.000 21.000 N FMNL2 n/a
2 TRCN0000018088 CCTCAACTACATGCGATTATA pLKO.1 2828 CDS 100% 15.000 21.000 N FMNL2 n/a
3 TRCN0000364655 CTGTTAATGGTGCCGAAATAA pLKO_005 3681 CDS 100% 15.000 21.000 N FMNL2 n/a
4 TRCN0000018092 GCCAGGTTACTGCGGCAGTAT pLKO.1 575 CDS 100% 1.650 1.320 N FMNL2 n/a
5 TRCN0000364581 ACTTTATGTGCTACGATTTAA pLKO_005 3766 3UTR 100% 15.000 10.500 N FMNL2 n/a
6 TRCN0000251748 CAAACACTGTTGCACTATATA pLKO_005 3011 CDS 100% 15.000 10.500 N Fmnl2 n/a
7 TRCN0000369345 CAAACACTGTTGCACTATATA pLKO_005 3011 CDS 100% 15.000 10.500 N FMNL2 n/a
8 TRCN0000369378 CCGGTTTGTGAAAGCATATAA pLKO_005 3355 CDS 100% 15.000 10.500 N FMNL2 n/a
9 TRCN0000018091 CCCTTGGAAACTACATGAATA pLKO.1 2910 CDS 100% 13.200 9.240 N FMNL2 n/a
10 TRCN0000018089 GCCAAGCAGAAGAACTCTGAA pLKO.1 1039 CDS 100% 4.950 3.465 N FMNL2 n/a
11 TRCN0000018090 CCTGGACGAATACTTGGACAA pLKO.1 1474 CDS 100% 4.050 2.835 N FMNL2 n/a
12 TRCN0000369304 TTACGTGCCATCATGAATTAT pLKO_005 1112 CDS 100% 15.000 9.000 N FMNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052905.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13038 pDONR223 100% 14.8% 13.9% None (many diffs) n/a
2 ccsbBroad304_13038 pLX_304 0% 14.8% 13.9% V5 (many diffs) n/a
Download CSV