Transcript: Human NM_052937.4

Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 (PCMTD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
PCMTD1 (115294)
Length:
4044
CDS:
203..1276

Additional Resources:

NCBI RefSeq record:
NM_052937.4
NBCI Gene record:
PCMTD1 (115294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052937.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236082 GGAAGTGGAACCGGATATTTA pLKO_005 464 CDS 100% 15.000 21.000 N PCMTD1 n/a
2 TRCN0000236080 GTACAATGGTGGGCTTAATTT pLKO_005 486 CDS 100% 15.000 21.000 N PCMTD1 n/a
3 TRCN0000250371 GTACAATGGTGGGCTTAATTT pLKO_005 486 CDS 100% 15.000 21.000 N Pcmtd1 n/a
4 TRCN0000216493 GTCATCAGTATGATCGAATTT pLKO.1 672 CDS 100% 13.200 18.480 N Pcmtd1 n/a
5 TRCN0000137368 GCTCCAGTAATTCCACAACAT pLKO.1 2812 3UTR 100% 4.950 6.930 N PCMTD1 n/a
6 TRCN0000236084 TCATCAGTATGATCGAATTTA pLKO_005 673 CDS 100% 15.000 10.500 N PCMTD1 n/a
7 TRCN0000258042 TCATCAGTATGATCGAATTTA pLKO_005 673 CDS 100% 15.000 10.500 N Pcmtd1 n/a
8 TRCN0000135847 CAGAACACTTGGGAAAGTAAA pLKO.1 809 CDS 100% 13.200 9.240 N PCMTD1 n/a
9 TRCN0000236081 TGATCGTGGAGATTACTATTT pLKO_005 310 CDS 100% 13.200 9.240 N PCMTD1 n/a
10 TRCN0000236083 TGCCTATAGAGGATCAGTTAA pLKO_005 768 CDS 100% 13.200 9.240 N PCMTD1 n/a
11 TRCN0000138259 CTACAGGACTTGGCTCGTATT pLKO.1 929 CDS 100% 10.800 7.560 N PCMTD1 n/a
12 TRCN0000135233 CCTGAAACATACAGTGAGTTA pLKO.1 3736 3UTR 100% 4.950 3.465 N PCMTD1 n/a
13 TRCN0000137498 GCATTGAAACTTCAACCAGGA pLKO.1 425 CDS 100% 2.160 1.512 N PCMTD1 n/a
14 TRCN0000137199 GAGGCATATTAGTCATGCCTA pLKO.1 753 CDS 100% 0.264 0.185 N PCMTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052937.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09416 pDONR223 100% 99.8% 99.7% None 507G>A;935A>T n/a
2 TRCN0000470013 AAACCACTCCTAACGATAACTAAC pLX_317 28.4% 99.8% 99.7% V5 507G>A;935A>T n/a
Download CSV