Transcript: Human NM_052960.3

Homo sapiens retinol binding protein 7 (RBP7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RBP7 (116362)
Length:
625
CDS:
32..436

Additional Resources:

NCBI RefSeq record:
NM_052960.3
NBCI Gene record:
RBP7 (116362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426427 GCAGACTGAACAGACGTTTAT pLKO_005 492 3UTR 100% 13.200 18.480 N RBP7 n/a
2 TRCN0000059438 CTAAGGAACTACTTTGTGAAA pLKO.1 203 CDS 100% 4.950 6.930 N RBP7 n/a
3 TRCN0000059440 GAGTTTGGTTATCTGGGACAA pLKO.1 283 CDS 100% 4.050 5.670 N RBP7 n/a
4 TRCN0000431919 CCTGTATCCAGAAGGGAGAAA pLKO_005 315 CDS 100% 4.950 3.465 N RBP7 n/a
5 TRCN0000059442 ACAGAAAGTGATTGAGCAGAA pLKO.1 148 CDS 100% 4.050 2.835 N RBP7 n/a
6 TRCN0000059441 CCACCTGGAAATGTTCTGTGA pLKO.1 379 CDS 100% 2.640 1.848 N RBP7 n/a
7 TRCN0000059439 GTATTGACTTTGCCACTCGTA pLKO.1 105 CDS 100% 2.640 1.848 N RBP7 n/a
8 TRCN0000105567 CCACAGAAAGTGATTGAGCAA pLKO.1 146 CDS 100% 2.640 1.848 N Rbp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04706 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04706 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473075 ATGAGACTATCCGAGAGTATTGTA pLX_317 87.9% 100% 100% V5 n/a
Download CSV