Transcript: Human NM_052962.3

Homo sapiens interleukin 22 receptor subunit alpha 2 (IL22RA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
IL22RA2 (116379)
Length:
2893
CDS:
298..1089

Additional Resources:

NCBI RefSeq record:
NM_052962.3
NBCI Gene record:
IL22RA2 (116379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372639 AGACATACAGGAACCTTATTA pLKO_005 672 CDS 100% 15.000 12.000 N IL22RA2 n/a
2 TRCN0000058465 GCGGTTGAAATTGAAGCTCTA pLKO.1 970 CDS 100% 4.050 3.240 N IL22RA2 n/a
3 TRCN0000372640 CTCGTGTTTGAAGGATCTTAT pLKO_005 1149 3UTR 100% 13.200 9.240 N IL22RA2 n/a
4 TRCN0000372581 TGCTCCAAATTTACCATATAG pLKO_005 834 CDS 100% 13.200 9.240 N IL22RA2 n/a
5 TRCN0000058466 CATGAATATAACCCAAGTCAA pLKO.1 789 CDS 100% 4.950 3.465 N IL22RA2 n/a
6 TRCN0000058467 GCTAAATATGGACAGAGACAA pLKO.1 586 CDS 100% 4.950 3.465 N IL22RA2 n/a
7 TRCN0000058463 GCTACTGTGTAGTGGCTGAAA pLKO.1 1004 CDS 100% 4.950 3.465 N IL22RA2 n/a
8 TRCN0000058464 GTACAATTTCAGTCCCGAAAT pLKO.1 397 CDS 100% 1.080 0.756 N IL22RA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04708 pDONR223 100% 87.8% 87.8% None 198_293del n/a
2 ccsbBroad304_04708 pLX_304 0% 87.8% 87.8% V5 198_293del n/a
3 TRCN0000472236 GAGACACGTGAAATGGTGCCCTGG pLX_317 59.7% 87.8% 87.8% V5 198_293del n/a
Download CSV