Transcript: Human NM_053004.3

Homo sapiens G protein subunit beta 1 like (GNB1L), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GNB1L (54584)
Length:
6642
CDS:
173..1156

Additional Resources:

NCBI RefSeq record:
NM_053004.3
NBCI Gene record:
GNB1L (54584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036903 GATCAGCCTCTGGTCACTCTA pLKO.1 1123 CDS 100% 4.950 6.930 N GNB1L n/a
2 TRCN0000433714 GATCCGGCCAGATCGCAAGAT pLKO_005 952 CDS 100% 1.650 2.310 N GNB1L n/a
3 TRCN0000036901 CGTGTTCCACTGGCGGACGAT pLKO.1 1006 CDS 100% 0.000 0.000 N GNB1L n/a
4 TRCN0000036900 CGAGGTTCAGATTCTGGAGAT pLKO.1 586 CDS 100% 4.050 2.835 N GNB1L n/a
5 TRCN0000436626 CTATGAGGATGGATCGGTGGT pLKO_005 724 CDS 100% 2.160 1.512 N GNB1L n/a
6 TRCN0000036899 GCCCGTCATGGACCTTGACTT pLKO.1 799 CDS 100% 1.650 1.155 N GNB1L n/a
7 TRCN0000036902 CCTGGTACACATCTGGAGCCT pLKO.1 313 CDS 100% 0.220 0.132 N GNB1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03439 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03439 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471508 TAGCTCCATCCCTTCTTTCTTACA pLX_317 45% 100% 100% V5 n/a
Download CSV