Transcript: Human NM_053034.2

Homo sapiens ANTXR cell adhesion molecule 1 (ANTXR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ANTXR1 (84168)
Length:
1667
CDS:
357..1463

Additional Resources:

NCBI RefSeq record:
NM_053034.2
NBCI Gene record:
ANTXR1 (84168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431985 AGAAGTCCTGCATCGAAATTC pLKO_005 1006 CDS 100% 13.200 9.240 N ANTXR1 n/a
2 TRCN0000063220 CAAGGCATCATCCACTCAATT pLKO.1 981 CDS 100% 13.200 9.240 N ANTXR1 n/a
3 TRCN0000063221 GCTGCACCACTGGAATGAAAT pLKO.1 521 CDS 100% 13.200 9.240 N ANTXR1 n/a
4 TRCN0000063219 CCCACAGTTGAGAATGTCCTT pLKO.1 581 CDS 100% 2.640 1.848 N ANTXR1 n/a
5 TRCN0000416148 TCTGCAGCTTCAAGATCAATG pLKO_005 1123 CDS 100% 10.800 6.480 N ANTXR1 n/a
6 TRCN0000063218 CCGAGGAACAACCTTAATGAA pLKO.1 617 CDS 100% 5.625 3.375 N ANTXR1 n/a
7 TRCN0000063222 ACACTCAATGAGAAGCCCTTT pLKO.1 1152 CDS 100% 4.050 2.430 N ANTXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04338 pDONR223 100% 88.3% 85.7% None (many diffs) n/a
2 ccsbBroad304_04338 pLX_304 0% 88.3% 85.7% V5 (many diffs) n/a
3 TRCN0000475197 CTAAAAGTAAAAATAGTAAACTGC pLX_317 57.5% 88.3% 85.7% V5 (many diffs) n/a
Download CSV