Transcript: Mouse NM_053110.4

Mus musculus glycoprotein (transmembrane) nmb (Gpnmb), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gpnmb (93695)
Length:
3798
CDS:
206..1930

Additional Resources:

NCBI RefSeq record:
NM_053110.4
NBCI Gene record:
Gpnmb (93695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053110.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011931 GCTAATGGCAATATCGTCTAT pLKO.1 533 CDS 100% 4.950 6.930 N Gpnmb n/a
2 TRCN0000294525 GCTAATGGCAATATCGTCTAT pLKO_005 533 CDS 100% 4.950 6.930 N Gpnmb n/a
3 TRCN0000011932 GATGTGTATGTGATAACAGAT pLKO.1 887 CDS 100% 4.950 3.960 N Gpnmb n/a
4 TRCN0000294523 GATGTGTATGTGATAACAGAT pLKO_005 887 CDS 100% 4.950 3.960 N Gpnmb n/a
5 TRCN0000294593 GTGTACATATTCTACTCATTA pLKO_005 2364 3UTR 100% 13.200 9.240 N Gpnmb n/a
6 TRCN0000307370 GGAGCTTTGTCTACGTCTTTC pLKO_005 717 CDS 100% 10.800 7.560 N Gpnmb n/a
7 TRCN0000011929 CCGAATAAACAGATATGGCTA pLKO.1 1324 CDS 100% 2.640 1.848 N Gpnmb n/a
8 TRCN0000011930 CCTCTTTAATGCCTACTGGTT pLKO.1 1263 CDS 100% 2.640 1.848 N Gpnmb n/a
9 TRCN0000294524 CCTCTTTAATGCCTACTGGTT pLKO_005 1263 CDS 100% 2.640 1.848 N Gpnmb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053110.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.