Transcript: Mouse NM_053169.2

Mus musculus tripartite motif-containing 16 (Trim16), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trim16 (94092)
Length:
3896
CDS:
253..1923

Additional Resources:

NCBI RefSeq record:
NM_053169.2
NBCI Gene record:
Trim16 (94092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115553 GCTCGGTATCTATGTAAACTT pLKO.1 1710 CDS 100% 5.625 7.875 N Trim16 n/a
2 TRCN0000354035 GCTCGGTATCTATGTAAACTT pLKO_005 1710 CDS 100% 5.625 7.875 N Trim16 n/a
3 TRCN0000115554 CGCAAGTATAGGACCTCGAAA pLKO.1 1285 CDS 100% 4.950 6.930 N Trim16 n/a
4 TRCN0000325168 CGCAAGTATAGGACCTCGAAA pLKO_005 1285 CDS 100% 4.950 6.930 N Trim16 n/a
5 TRCN0000115552 CGGGATGAGTTTCTTCAATAT pLKO.1 1321 CDS 100% 13.200 10.560 N Trim16 n/a
6 TRCN0000325090 CGGGATGAGTTTCTTCAATAT pLKO_005 1321 CDS 100% 13.200 10.560 N Trim16 n/a
7 TRCN0000115551 CCTGTTTGTTTGTGCTAAGTT pLKO.1 2838 3UTR 100% 5.625 3.938 N Trim16 n/a
8 TRCN0000115555 GCAGAGTAAGGGCAGTGAAAT pLKO.1 479 CDS 100% 13.200 7.920 N Trim16 n/a
9 TRCN0000325166 GCAGAGTAAGGGCAGTGAAAT pLKO_005 479 CDS 100% 13.200 7.920 N Trim16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09642 pDONR223 100% 53.2% 52.3% None (many diffs) n/a
2 TRCN0000476581 AATAGGTTAAACCGGCTGCTGCGC pLX_317 34.9% 53.2% 52.3% V5 (many diffs) n/a
Download CSV