Transcript: Mouse NM_053214.2

Mus musculus myosin IF (Myo1f), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myo1f (17916)
Length:
3833
CDS:
148..3444

Additional Resources:

NCBI RefSeq record:
NM_053214.2
NBCI Gene record:
Myo1f (17916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448060 GCCGCTTCAAGCCTATCAAAC pLKO_005 2465 CDS 100% 10.800 8.640 N Myo1f n/a
2 TRCN0000447795 ACAAGGTCCAGCACGTCAAAG pLKO_005 551 CDS 100% 10.800 7.560 N Myo1f n/a
3 TRCN0000100456 CCCAGAGGTTTGAATCGAAAT pLKO.1 2995 CDS 100% 10.800 7.560 N Myo1f n/a
4 TRCN0000100457 GCCGTAAGATGGACAGCAAAT pLKO.1 1115 CDS 100% 10.800 7.560 N Myo1f n/a
5 TRCN0000100459 AGCCGTAAGATGGACAGCAAA pLKO.1 1114 CDS 100% 4.950 3.465 N Myo1f n/a
6 TRCN0000100458 CCTACTTCACTGACCGAGAAA pLKO.1 338 CDS 100% 4.950 3.465 N Myo1f n/a
7 TRCN0000100455 CTTGCTATCTAAGTCTCCATT pLKO.1 3629 3UTR 100% 4.950 3.465 N Myo1f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01048 pDONR223 100% 86.1% 93.7% None (many diffs) n/a
2 ccsbBroad304_01048 pLX_304 0% 86.1% 93.7% V5 (many diffs) n/a
3 TRCN0000468331 TCTTCATGACGGATTGAACCCCCT pLX_317 12.8% 86.1% 93.7% V5 (many diffs) n/a
Download CSV