Transcript: Human NM_053279.3

Homo sapiens family with sequence similarity 167 member A (FAM167A), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FAM167A (83648)
Length:
4067
CDS:
526..1170

Additional Resources:

NCBI RefSeq record:
NM_053279.3
NBCI Gene record:
FAM167A (83648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072670 CAAGCTTATTGGCGTGACCAA pLKO.1 1113 CDS 100% 2.640 3.696 N FAM167A n/a
2 TRCN0000072672 GAACATCAACTCTCGGAGGTT pLKO.1 1137 CDS 100% 2.640 3.696 N FAM167A n/a
3 TRCN0000072668 CCTCTAAGTATTGTCTCAAAT pLKO.1 1624 3UTR 100% 13.200 9.240 N FAM167A n/a
4 TRCN0000072671 TGGCGACATCAACAAGCTGAA pLKO.1 960 CDS 100% 4.050 2.835 N FAM167A n/a
5 TRCN0000072669 GAAGGCTTTCAGAGCATCGAT pLKO.1 856 CDS 100% 3.000 2.100 N FAM167A n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3139 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09103 pDONR223 100% 99.8% 99.5% None 168T>G n/a
2 ccsbBroad304_09103 pLX_304 0% 99.8% 99.5% V5 168T>G n/a
3 TRCN0000467090 TTTGCATTTCGGACCAAGTGCCTA pLX_317 56.3% 99.8% 99.5% V5 168T>G n/a
Download CSV