Transcript: Human NM_054024.4

Homo sapiens MIA SH3 domain ER export factor 2 (MIA2), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MIA2 (4253)
Length:
2555
CDS:
201..2165

Additional Resources:

NCBI RefSeq record:
NM_054024.4
NBCI Gene record:
MIA2 (4253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054024.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134213 CAAGCCAAGTTGGTTTGATTT pLKO.1 1319 CDS 100% 13.200 10.560 N n/a
2 TRCN0000134353 GAACCCTCATCTTCTAAAGAT pLKO.1 1821 CDS 100% 5.625 3.938 N n/a
3 TRCN0000133829 CAGCAAGAATCTGAATCAGAA pLKO.1 1029 CDS 100% 4.950 3.465 N n/a
4 TRCN0000138770 GATGAGGATACAGGGCTTGAA pLKO.1 1164 CDS 100% 4.950 3.465 N n/a
5 TRCN0000134070 GATGCTTCTGAGTTTCAGATT pLKO.1 1989 CDS 100% 4.950 3.465 N n/a
6 TRCN0000138251 CCAAACCTCAATCCACTGGTT pLKO.1 1105 CDS 100% 2.640 1.848 N n/a
7 TRCN0000134955 GCATATGCCAAGGAAGATAAA pLKO.1 1362 CDS 100% 0.000 0.000 N n/a
8 TRCN0000134681 GAGTCAAAGAATGGTTTGGAT pLKO.1 865 CDS 100% 3.000 1.800 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054024.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04721 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04721 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465663 TATCAAGGGATTTCACCCCGGACT pLX_317 15.6% 100% 100% V5 n/a
Download CSV