Transcript: Human NM_054026.3

Homo sapiens CCR4-NOT transcription complex subunit 7 (CNOT7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CNOT7 (29883)
Length:
1990
CDS:
331..1065

Additional Resources:

NCBI RefSeq record:
NM_054026.3
NBCI Gene record:
CNOT7 (29883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017868 CGGTGTAATGTAGACTTGTTA pLKO.1 526 CDS 100% 5.625 7.875 N CNOT7 n/a
2 TRCN0000318847 CGGTGTAATGTAGACTTGTTA pLKO_005 526 CDS 100% 5.625 7.875 N CNOT7 n/a
3 TRCN0000095975 GCGGTGTAATGTAGACTTGTT pLKO.1 525 CDS 100% 4.950 6.930 N Cnot7 n/a
4 TRCN0000017869 GCTACTAACAACATCTGGTAT pLKO.1 672 CDS 100% 4.950 3.960 N CNOT7 n/a
5 TRCN0000017870 GCTGACTATCAATACCAACTA pLKO.1 502 CDS 100% 4.950 3.960 N CNOT7 n/a
6 TRCN0000318848 GCTGACTATCAATACCAACTA pLKO_005 502 CDS 100% 4.950 3.960 N CNOT7 n/a
7 TRCN0000017872 CGGTTACGACTTTGGCTACTT pLKO.1 804 CDS 100% 4.950 3.465 N CNOT7 n/a
8 TRCN0000349651 CGGTTACGACTTTGGCTACTT pLKO_005 804 CDS 100% 4.950 3.465 N CNOT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11909 pDONR223 100% 95.8% 95.5% None (many diffs) n/a
2 ccsbBroad304_11909 pLX_304 0% 95.8% 95.5% V5 (many diffs) n/a
3 TRCN0000475112 AAGTTTTCGTATTTGATCATCATC pLX_317 49.3% 95.8% 95.5% V5 (many diffs) n/a
4 ccsbBroadEn_03097 pDONR223 100% 85.3% 85.2% None 730G>A;732_732delAins124 n/a
5 ccsbBroad304_03097 pLX_304 0% 85.3% 85.2% V5 730G>A;732_732delAins124 n/a
6 TRCN0000466126 TCGAGCCATATCGGGGGAGGTCTG pLX_317 43.4% 85.3% 85.2% V5 730G>A;732_732delAins124 n/a
Download CSV