Transcript: Human NM_054110.5

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 15 (GALNT15), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GALNT15 (117248)
Length:
5057
CDS:
473..2392

Additional Resources:

NCBI RefSeq record:
NM_054110.5
NBCI Gene record:
GALNT15 (117248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054110.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035436 CCGAGTGGTATCTCCGGTGAT pLKO.1 1387 CDS 100% 1.350 1.890 N GALNT15 n/a
2 TRCN0000035435 TGTCGGACATTCCACTGGTTT pLKO.1 1916 CDS 100% 4.950 3.960 N GALNT15 n/a
3 TRCN0000425167 AGTCTGCTCTCAGCGAATATG pLKO_005 1188 CDS 100% 13.200 9.240 N GALNT15 n/a
4 TRCN0000423009 GATGATTGTCCACATTCTTTC pLKO_005 2251 CDS 100% 10.800 7.560 N GALNT15 n/a
5 TRCN0000093982 TGGACAGACATTACTTCCAAA pLKO.1 1584 CDS 100% 4.950 3.465 N Galnt15 n/a
6 TRCN0000035434 GACCAGATCAATGCTGTGGAT pLKO.1 2363 CDS 100% 2.640 1.848 N GALNT15 n/a
7 TRCN0000035438 CCTGAGGAACAGGGTTCGCAT pLKO.1 1771 CDS 100% 0.880 0.616 N GALNT15 n/a
8 TRCN0000035437 GCAGCCAAGGAGGCAGGATAA pLKO.1 835 CDS 100% 3.600 2.160 N GALNT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054110.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09447 pDONR223 100% 99.8% 99.8% None 810G>A;1294G>A n/a
2 ccsbBroad304_09447 pLX_304 0% 99.8% 99.8% V5 810G>A;1294G>A n/a
3 TRCN0000467061 ACGAAATATTGCTAAGACTAAATC pLX_317 18.3% 99.8% 99.8% V5 810G>A;1294G>A n/a
Download CSV