Transcript: Human NM_078488.2

Homo sapiens vanin 2 (VNN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
VNN2 (8875)
Length:
1961
CDS:
113..1516

Additional Resources:

NCBI RefSeq record:
NM_078488.2
NBCI Gene record:
VNN2 (8875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_078488.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418836 GTGACTTTCAACACCGCATTT pLKO_005 542 CDS 100% 10.800 15.120 N VNN2 n/a
2 TRCN0000160770 CTGAAGTGCTACTTACCGAAA pLKO.1 1278 CDS 100% 4.050 5.670 N VNN2 n/a
3 TRCN0000158893 GCAATAACTTACCTGCTAATA pLKO.1 1448 CDS 100% 13.200 9.240 N VNN2 n/a
4 TRCN0000159142 GAAACCTTACAGTCTGTCAAA pLKO.1 1020 CDS 100% 4.950 3.465 N VNN2 n/a
5 TRCN0000161721 CGAATCATTGTGACTCCAGAA pLKO.1 173 CDS 100% 4.050 2.835 N VNN2 n/a
6 TRCN0000159176 GAAGTGGTATTTATGCACCAA pLKO.1 780 CDS 100% 2.640 1.848 N VNN2 n/a
7 TRCN0000158666 CCCAAGTTTACTAAGAAACTT pLKO.1 1577 3UTR 100% 0.563 0.338 N VNN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_078488.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02037 pDONR223 100% 89.8% 89.8% None 0_1ins159 n/a
2 ccsbBroad304_02037 pLX_304 0% 89.8% 89.8% V5 0_1ins159 n/a
3 TRCN0000468576 GCCTGTGAGGCATTAGTATCCTCG pLX_317 21.2% 89.8% 89.8% V5 0_1ins159 n/a
4 ccsbBroadEn_15647 pDONR223 0% 89.6% 89.8% None 0_1ins159;297A>G;675T>C n/a
5 ccsbBroad304_15647 pLX_304 0% 89.6% 89.8% V5 0_1ins159;297A>G;675T>C n/a
6 TRCN0000472670 GGCCCATCATGTAATCAAACAACT pLX_317 31.5% 89.6% 89.8% V5 0_1ins159;297A>G;675T>C n/a
Download CSV