Transcript: Human NM_079423.4

Homo sapiens myosin light chain 6 (MYL6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
MYL6 (4637)
Length:
663
CDS:
44..499

Additional Resources:

NCBI RefSeq record:
NM_079423.4
NBCI Gene record:
MYL6 (4637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_079423.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089642 GTGTTTGACAAGGAAGGAAAT pLKO.1 326 CDS 100% 10.800 7.560 N Gm5526 n/a
2 TRCN0000203555 GTGTTTGACAAGGAAGGAAAT pLKO.1 326 CDS 100% 10.800 7.560 N MYL6P5 n/a
3 TRCN0000091896 GAGTGATGAGATGAATGTGAA pLKO.1 211 CDS 100% 4.950 3.465 N LOC434349 n/a
4 TRCN0000054140 GCTGAAATCCGGCATGTTCTT pLKO.1 362 CDS 100% 4.950 3.465 N MYL6 n/a
5 TRCN0000333404 GCTGAAATCCGGCATGTTCTT pLKO_005 362 CDS 100% 4.950 3.465 N MYL6 n/a
6 TRCN0000054142 CATGAGGACAGCAATGGTTGT pLKO.1 437 CDS 100% 4.050 2.835 N MYL6 n/a
7 TRCN0000333405 CATGAGGACAGCAATGGTTGT pLKO_005 437 CDS 100% 4.050 2.835 N MYL6 n/a
8 TRCN0000091745 GAATGTGAAGGTGCTGGACTT pLKO.1 223 CDS 100% 4.050 2.835 N LOC384933 n/a
9 TRCN0000369808 TCGTCCGCATGGTGCTGAATG pLKO_005 474 CDS 100% 3.600 2.520 N MYL6 n/a
10 TRCN0000054141 ACCTATGAGGATTATGTCGAA pLKO.1 296 CDS 100% 2.640 1.848 N MYL6 n/a
11 TRCN0000204259 CTTTGAGCACTTTCTGCCCAT pLKO.1 241 CDS 100% 2.160 1.512 N MYL6P5 n/a
12 TRCN0000054139 GTGCTGGACTTTGAGCACTTT pLKO.1 233 CDS 100% 0.495 0.347 N MYL6 n/a
13 TRCN0000054138 CCCAAGAGTGATGAGATGAAT pLKO.1 206 CDS 100% 5.625 3.375 N MYL6 n/a
14 TRCN0000333403 CCCAAGAGTGATGAGATGAAT pLKO_005 206 CDS 100% 5.625 3.375 N MYL6 n/a
15 TRCN0000090021 GCAGGGCATGAGGACAGCAAT pLKO.1 431 CDS 100% 1.650 0.990 N Gm11836 n/a
16 TRCN0000090212 GCACCGTCATGGGTGCTGAAA pLKO.1 348 CDS 100% 0.165 0.099 N Myl6 n/a
17 TRCN0000090210 GAGGAAGAAGTAGAGATGCTA pLKO.1 407 CDS 100% 3.000 2.100 N Myl6 n/a
18 TRCN0000287542 GAGGAAGAAGTAGAGATGCTA pLKO_005 407 CDS 100% 3.000 2.100 N Myl6 n/a
19 TRCN0000091035 GTGGCCAAGAACAAGGACCAA pLKO.1 272 CDS 100% 2.640 1.848 N LOC436413 n/a
20 TRCN0000091747 TGATGGCAAGATCCTGTACAA pLKO.1 112 CDS 100% 4.950 2.970 N LOC384933 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_079423.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01057 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01057 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479700 AGCTATAGGCCAGAAAACCAGACT pLX_317 64.9% 100% 100% V5 n/a
4 ccsbBroadEn_06610 pDONR223 100% 99.7% 100% None 211C>T n/a
5 ccsbBroad304_06610 pLX_304 0% 99.7% 100% V5 211C>T n/a
6 TRCN0000472467 ACCTACGAGAAGCCCAATTAATGC pLX_317 100% 99.7% 100% V5 211C>T n/a
7 ccsbBroadEn_06609 pDONR223 100% 97.3% 96.6% None (many diffs) n/a
8 ccsbBroad304_06609 pLX_304 0% 97.3% 96.6% V5 (many diffs) n/a
9 TRCN0000478566 GTCACGTAATGTCGCCCCGTTCGT pLX_317 88.5% 97.3% 96.6% V5 (many diffs) n/a
Download CSV