Transcript: Human NM_080387.5

Homo sapiens C-type lectin domain family 4 member D (CLEC4D), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CLEC4D (338339)
Length:
1973
CDS:
231..878

Additional Resources:

NCBI RefSeq record:
NM_080387.5
NBCI Gene record:
CLEC4D (338339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080387.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416512 TATGGAAGAATAGCGTGAATA pLKO_005 1175 3UTR 100% 13.200 18.480 N CLEC4D n/a
2 TRCN0000055600 GCATAAGAATGAACCCGACAA pLKO.1 737 CDS 100% 4.050 3.240 N CLEC4D n/a
3 TRCN0000055598 GCTGAGCAGAACTTTATTATT pLKO.1 606 CDS 100% 15.000 10.500 N CLEC4D n/a
4 TRCN0000428280 AGTAGTATTTCAAGGTGTTTA pLKO_005 1125 3UTR 100% 13.200 9.240 N CLEC4D n/a
5 TRCN0000055599 CCTTCGGTTATTGCTGTAGTT pLKO.1 288 CDS 100% 4.950 3.465 N CLEC4D n/a
6 TRCN0000055602 GCAAGTTGTTTGGTGACTCAT pLKO.1 339 CDS 100% 4.950 3.465 N CLEC4D n/a
7 TRCN0000055601 CCAAGATAAATGGGCCTGGAA pLKO.1 794 CDS 100% 2.640 1.848 N CLEC4D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080387.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05435 pLX_304 0% 100% 100% V5 n/a
Download CSV