Transcript: Mouse NM_080435.1

Mus musculus adenylate cyclase 4 (Adcy4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Adcy4 (104110)
Length:
3414
CDS:
113..3346

Additional Resources:

NCBI RefSeq record:
NM_080435.1
NBCI Gene record:
Adcy4 (104110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420467 CAACAAGCACTCGTTCAATAA pLKO_005 3037 CDS 100% 13.200 18.480 N Adcy4 n/a
2 TRCN0000114937 CGAATGCGTTTGTGTCCTCTT pLKO.1 2725 CDS 100% 4.050 5.670 N Adcy4 n/a
3 TRCN0000440846 TGCCTGACCACGCTATCAATT pLKO_005 1113 CDS 100% 13.200 10.560 N Adcy4 n/a
4 TRCN0000428191 GTTGGCAGCAAACGCGGTATT pLKO_005 631 CDS 100% 10.800 8.640 N Adcy4 n/a
5 TRCN0000114939 CGAACAACTCAACTCTCAGAA pLKO.1 1738 CDS 100% 4.950 3.960 N Adcy4 n/a
6 TRCN0000114938 CCTACATACCTGGTCATTGAT pLKO.1 1436 CDS 100% 5.625 3.938 N Adcy4 n/a
7 TRCN0000114936 CGACCTCTTTCTGGTCTCATA pLKO.1 380 CDS 100% 4.950 3.465 N Adcy4 n/a
8 TRCN0000114940 CCTGGTATTCACTATGGCCAT pLKO.1 2119 CDS 100% 2.160 1.512 N Adcy4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489624 GCCTTACCCTCATTAGGAGTCTGT pLX_317 9% 85.9% 91.7% V5 (many diffs) n/a
Download CSV