Transcript: Mouse NM_080463.3

Mus musculus protein O-fucosyltransferase 1 (Pofut1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pofut1 (140484)
Length:
5618
CDS:
56..1237

Additional Resources:

NCBI RefSeq record:
NM_080463.3
NBCI Gene record:
Pofut1 (140484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034941 CGGCCCTATGTGGGCATTCAT pLKO.1 764 CDS 100% 1.875 2.625 N POFUT1 n/a
2 TRCN0000246877 AGCCTAAAGTGACCTTATAAA pLKO_005 1812 3UTR 100% 15.000 10.500 N Pofut1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02783 pDONR223 100% 43.7% 42.4% None (many diffs) n/a
2 ccsbBroad304_02783 pLX_304 0% 43.7% 42.4% V5 (many diffs) n/a
3 TRCN0000473609 CGAGGATTCCATCGCAGCACAGCA pLX_317 81.3% 43.7% 42.4% V5 (many diffs) n/a
Download CSV