Transcript: Mouse NM_080467.3

Mus musculus ATPase, H+ transporting, lysosomal V0 subunit A4 (Atp6v0a4), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Atp6v0a4 (140494)
Length:
3300
CDS:
277..2778

Additional Resources:

NCBI RefSeq record:
NM_080467.3
NBCI Gene record:
Atp6v0a4 (140494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101389 CGGCATGTTTCTGTTCGACTA pLKO.1 2127 CDS 100% 4.050 5.670 N Atp6v0a4 n/a
2 TRCN0000101387 GCCTTGTGGATGGTCCTAAAT pLKO.1 1540 CDS 100% 13.200 9.240 N Atp6v0a4 n/a
3 TRCN0000101388 CCTCTTCAATCACATTTACTT pLKO.1 1953 CDS 100% 5.625 3.938 N Atp6v0a4 n/a
4 TRCN0000101385 GCCAAGGATGTCCTTGACTTT pLKO.1 3141 3UTR 100% 0.495 0.347 N Atp6v0a4 n/a
5 TRCN0000101386 CCTCAACATCATTCTGCAATT pLKO.1 1983 CDS 100% 10.800 6.480 N Atp6v0a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08179 pDONR223 100% 83.8% 85.7% None (many diffs) n/a
2 ccsbBroad304_08179 pLX_304 0% 83.8% 85.7% V5 (many diffs) n/a
3 TRCN0000466203 AGATCGAGCGTACGCGCATGTCTC pLX_317 15% 83.8% 85.7% V5 (many diffs) n/a
4 ccsbBroadEn_08180 pDONR223 100% 83.8% 85.7% None (many diffs) n/a
5 ccsbBroad304_08180 pLX_304 0% 83.8% 85.7% V5 (many diffs) n/a
6 TRCN0000481441 GGCGGATGTTTAGCACCTCACCTT pLX_317 18.9% 83.8% 85.7% V5 (many diffs) n/a
Download CSV