Transcript: Mouse NM_080554.2

Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (Psmd5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Psmd5 (66998)
Length:
2065
CDS:
41..1555

Additional Resources:

NCBI RefSeq record:
NM_080554.2
NBCI Gene record:
Psmd5 (66998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066208 CCCTGTCGAGAATATCACTAA pLKO.1 483 CDS 100% 4.950 3.465 N Psmd5 n/a
2 TRCN0000326886 CCCTGTCGAGAATATCACTAA pLKO_005 483 CDS 100% 4.950 3.465 N Psmd5 n/a
3 TRCN0000058117 CCTGTATAGAAATGGTGACAT pLKO.1 717 CDS 100% 4.950 3.465 N PSMD5 n/a
4 TRCN0000066209 CGGTCTGTGGAACATGACAAA pLKO.1 1370 CDS 100% 4.950 3.465 N Psmd5 n/a
5 TRCN0000326885 CGGTCTGTGGAACATGACAAA pLKO_005 1370 CDS 100% 4.950 3.465 N Psmd5 n/a
6 TRCN0000066212 GCTGAGCTGTTGAAACAGATT pLKO.1 410 CDS 100% 4.950 3.465 N Psmd5 n/a
7 TRCN0000326887 GCTGAGCTGTTGAAACAGATT pLKO_005 410 CDS 100% 4.950 3.465 N Psmd5 n/a
8 TRCN0000058115 CCATACTATGTGAAACCTGTT pLKO.1 1505 CDS 100% 4.050 2.835 N PSMD5 n/a
9 TRCN0000290086 CCATACTATGTGAAACCTGTT pLKO_005 1505 CDS 100% 4.050 2.835 N PSMD5 n/a
10 TRCN0000066210 CGTACCTAAGTGAAGGTCCAT pLKO.1 1488 CDS 100% 2.640 1.848 N Psmd5 n/a
11 TRCN0000066211 GACTGCTTTGTGTGTCTCCAT pLKO.1 220 CDS 100% 2.640 1.848 N Psmd5 n/a
12 TRCN0000326888 GACTGCTTTGTGTGTCTCCAT pLKO_005 220 CDS 100% 2.640 1.848 N Psmd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01321 pDONR223 100% 87.7% 89.8% None (many diffs) n/a
2 ccsbBroad304_01321 pLX_304 0% 87.7% 89.8% V5 (many diffs) n/a
3 TRCN0000475131 ATCCCAGGACCAGACCGACATACG pLX_317 36.4% 87.7% 89.8% V5 (many diffs) n/a
Download CSV