Transcript: Mouse NM_080563.4

Mus musculus ring finger protein 144A (Rnf144a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rnf144a (108089)
Length:
5115
CDS:
356..1234

Additional Resources:

NCBI RefSeq record:
NM_080563.4
NBCI Gene record:
Rnf144a (108089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040588 CCCGTGTCATTGCATTTCTTT pLKO.1 1969 3UTR 100% 5.625 7.875 N Rnf144a n/a
2 TRCN0000312888 TCCGGCTTGCTGCAGAGATTT pLKO_005 1349 3UTR 100% 13.200 9.240 N Rnf144a n/a
3 TRCN0000312929 TGATTTCCTTCTGATACATTA pLKO_005 1015 CDS 100% 13.200 9.240 N Rnf144a n/a
4 TRCN0000421486 ATGTTGAGCTCTTGATCAAAG pLKO_005 504 CDS 100% 10.800 7.560 N RNF144A n/a
5 TRCN0000040591 CCTTCGTGCTTTGCTGCAAAT pLKO.1 1173 CDS 100% 10.800 7.560 N Rnf144a n/a
6 TRCN0000311981 CCTTCGTGCTTTGCTGCAAAT pLKO_005 1173 CDS 100% 10.800 7.560 N Rnf144a n/a
7 TRCN0000040592 GAAGGGCTAGAAACTGCAATT pLKO.1 524 CDS 100% 10.800 7.560 N Rnf144a n/a
8 TRCN0000349406 GAAGGGCTAGAAACTGCAATT pLKO_005 524 CDS 100% 10.800 7.560 N Rnf144a n/a
9 TRCN0000040590 CCTTCTGATACATTATGACAA pLKO.1 1021 CDS 100% 4.950 3.465 N Rnf144a n/a
10 TRCN0000040589 CGCAGAAATAATGCAGAGATA pLKO.1 613 CDS 100% 4.950 3.465 N Rnf144a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07484 pDONR223 100% 89.2% 96.9% None (many diffs) n/a
2 ccsbBroad304_07484 pLX_304 0% 89.2% 96.9% V5 (many diffs) n/a
3 TRCN0000466327 CTTCTATGCCATAGGGAACGGAGT pLX_317 43.9% 89.2% 96.9% V5 (many diffs) n/a
Download CSV