Transcript: Human NM_080626.6

Homo sapiens BRI3 binding protein (BRI3BP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BRI3BP (140707)
Length:
6703
CDS:
147..902

Additional Resources:

NCBI RefSeq record:
NM_080626.6
NBCI Gene record:
BRI3BP (140707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080626.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242653 TGGCGCTGTGTAGGGCTATTT pLKO_005 1018 3UTR 100% 13.200 18.480 N BRI3BP n/a
2 TRCN0000180451 GATATGTTCGTGGAGACACTG pLKO.1 399 CDS 100% 4.050 5.670 N BRI3BP n/a
3 TRCN0000242650 CTCCAACCTGTCCCAGTATTT pLKO_005 464 CDS 100% 13.200 9.240 N BRI3BP n/a
4 TRCN0000242651 ATTTGTGCTGGGAGTGGATAT pLKO_005 383 CDS 100% 10.800 7.560 N BRI3BP n/a
5 TRCN0000252900 ACCGCTCCAAGGACAAGTGAA pLKO_005 883 CDS 100% 4.950 3.465 N Bri3bp n/a
6 TRCN0000242652 ACTGCTCAACATCCGTCTCAA pLKO_005 842 CDS 100% 4.950 3.465 N BRI3BP n/a
7 TRCN0000180326 CGTGTACATCCTGCACAAGTA pLKO.1 656 CDS 100% 4.950 3.465 N BRI3BP n/a
8 TRCN0000242649 TTTCCATGTCCTGCGTGTACA pLKO_005 643 CDS 100% 4.950 3.465 N BRI3BP n/a
9 TRCN0000164051 CATAGTGAAATCCCGTCTCTA pLKO.1 4801 3UTR 100% 4.950 2.475 Y PLIN5 n/a
10 TRCN0000164982 GCCAACATAGTGAAATCCCGT pLKO.1 4796 3UTR 100% 0.660 0.330 Y PLIN5 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2327 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3416 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3416 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080626.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.