Transcript: Mouse NM_080644.3

Mus musculus calcium channel, voltage-dependent, gamma subunit 5 (Cacng5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cacng5 (140723)
Length:
3678
CDS:
104..931

Additional Resources:

NCBI RefSeq record:
NM_080644.3
NBCI Gene record:
Cacng5 (140723)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069456 CCATAGAGTATGTGATGCCCA pLKO.1 324 CDS 100% 0.660 0.924 N Cacng5 n/a
2 TRCN0000428317 CTTCATGTTCATTGGGTTTAT pLKO_005 430 CDS 100% 13.200 9.240 N CACNG5 n/a
3 TRCN0000069457 TCTGAGCAACTGCTCCGATTA pLKO.1 763 CDS 100% 10.800 7.560 N Cacng5 n/a
4 TRCN0000069453 GACCTATTTCAACTACAAGTA pLKO.1 607 CDS 100% 4.950 3.465 N Cacng5 n/a
5 TRCN0000069455 CATTGGGTTTATCCTGAGCAA pLKO.1 439 CDS 100% 2.640 1.848 N Cacng5 n/a
6 TRCN0000069454 GAACAGCAACTACCCAGCTTT pLKO.1 865 CDS 100% 4.950 2.970 N Cacng5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02994 pDONR223 100% 89.4% 97% None (many diffs) n/a
2 ccsbBroad304_02994 pLX_304 0% 89.4% 97% V5 (many diffs) n/a
3 TRCN0000475930 ACAATACTGCATCTTCGATCAAAA pLX_317 34.9% 89.4% 97% V5 (many diffs) n/a
Download CSV