Transcript: Human NM_080659.3

Homo sapiens chromosome 11 open reading frame 52 (C11orf52), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C11orf52 (91894)
Length:
1104
CDS:
61..432

Additional Resources:

NCBI RefSeq record:
NM_080659.3
NBCI Gene record:
C11orf52 (91894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168107 CCACTGTTAGGTTGGAGTTAA pLKO.1 605 3UTR 100% 13.200 6.600 Y C11orf52 n/a
2 TRCN0000134569 GCTGATCTTGTTGGACTTTAA pLKO.1 781 3UTR 100% 13.200 6.600 Y C11orf52 n/a
3 TRCN0000414617 GAAGGCCCAGTCCATCGTTAA pLKO_005 444 3UTR 100% 10.800 5.400 Y C11orf52 n/a
4 TRCN0000430813 GGAATTGTGGGCGTCCCATTT pLKO_005 563 3UTR 100% 10.800 5.400 Y C11orf52 n/a
5 TRCN0000134740 GTGAAACACGTGCATTTAGAA pLKO.1 334 CDS 100% 5.625 2.813 Y C11orf52 n/a
6 TRCN0000166859 CAACTTACATTATGCTGACAT pLKO.1 282 CDS 100% 4.950 2.475 Y C11orf52 n/a
7 TRCN0000135775 CATACGTATGAACGGGTGTTA pLKO.1 211 CDS 100% 4.950 2.475 Y C11orf52 n/a
8 TRCN0000137343 CCAAACAAGACGGACACTGAA pLKO.1 135 CDS 100% 4.950 2.475 Y C11orf52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09326 pDONR223 100% 99.7% 99.1% None 68C>G n/a
2 ccsbBroad304_09326 pLX_304 0% 99.7% 99.1% V5 68C>G n/a
3 TRCN0000468635 ACGGGAGGTTCTCACCCACTGTAA pLX_317 100% 99.7% 99.1% V5 68C>G n/a
Download CSV