Transcript: Human NM_080660.4

Homo sapiens zinc finger CCCH-type containing, antiviral 1 like (ZC3HAV1L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZC3HAV1L (92092)
Length:
1766
CDS:
26..928

Additional Resources:

NCBI RefSeq record:
NM_080660.4
NBCI Gene record:
ZC3HAV1L (92092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080660.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149040 GCTTATCCATGCTGCATCTTT pLKO.1 661 CDS 100% 5.625 7.875 N ZC3HAV1L n/a
2 TRCN0000129759 CCTCAAGGATAAATGCAACAA pLKO.1 574 CDS 100% 4.950 3.960 N ZC3HAV1L n/a
3 TRCN0000435352 AGGACCAAGGACTGAATATTC pLKO_005 693 CDS 100% 13.200 9.240 N ZC3HAV1L n/a
4 TRCN0000435282 ATTTGTTCACATCGTACATAA pLKO_005 1242 3UTR 100% 13.200 9.240 N ZC3HAV1L n/a
5 TRCN0000430731 CACTTAATATTGTCTCATAAG pLKO_005 1210 3UTR 100% 10.800 7.560 N ZC3HAV1L n/a
6 TRCN0000146497 CCTAGAGTACTTTGCACTCAT pLKO.1 1179 3UTR 100% 4.950 3.465 N ZC3HAV1L n/a
7 TRCN0000147172 CTAGAGTACTTTGCACTCATT pLKO.1 1180 3UTR 100% 4.950 3.465 N ZC3HAV1L n/a
8 TRCN0000131208 GAACAGGCAAAGAGAGGCTAA pLKO.1 1006 3UTR 100% 4.050 2.835 N ZC3HAV1L n/a
9 TRCN0000149479 GCAACAAGTTTCATGTGTGCA pLKO.1 588 CDS 100% 2.640 1.848 N ZC3HAV1L n/a
10 TRCN0000152482 CTACTGCAACCTCAAGGATTA pLKO.1 565 CDS 100% 10.800 5.400 Y MARVELD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080660.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.