Transcript: Human NM_080827.2

Homo sapiens WAP four-disulfide core domain 6 (WFDC6), mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
WFDC6 (140870)
Length:
607
CDS:
76..336

Additional Resources:

NCBI RefSeq record:
NM_080827.2
NBCI Gene record:
WFDC6 (140870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073713 GCCTGATTGATGCTCCAAATT pLKO.1 379 3UTR 100% 13.200 9.240 N WFDC6 n/a
2 TRCN0000073714 CAGCCTTACTTTATACCATAA pLKO.1 300 CDS 100% 10.800 7.560 N WFDC6 n/a
3 TRCN0000373958 ACCTTGGCTGTTCCAGAAACT pLKO_005 416 3UTR 100% 4.950 3.465 N WFDC6 n/a
4 TRCN0000373959 CTTGGCAAGCCGTGTCCCAAA pLKO_005 160 CDS 100% 1.350 0.945 N WFDC6 n/a
5 TRCN0000373960 CCTCCAGGATTTGGCTCATAA pLKO_005 337 CDS 100% 13.200 7.920 N WFDC6 n/a
6 TRCN0000073717 CAGCCGTGGAAAGAAATGTTT pLKO.1 264 CDS 100% 5.625 2.813 Y WFDC6 n/a
7 TRCN0000073716 TGGAATGCGAAGTGGAAGAAA pLKO.1 188 CDS 100% 5.625 2.813 Y WFDC6 n/a
8 TRCN0000073715 GAAATAGACCAGTGTACCAAA pLKO.1 205 CDS 100% 4.950 2.475 Y WFDC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04954 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04954 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477875 ACCATGGGCGGGACACCCTTGCAC pLX_317 80.4% 100% 100% V5 n/a
Download CSV