Transcript: Human NM_080870.4

Homo sapiens mucin like 3 (MUCL3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
MUCL3 (135656)
Length:
5313
CDS:
28..4209

Additional Resources:

NCBI RefSeq record:
NM_080870.4
NBCI Gene record:
MUCL3 (135656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083673 CCGGACTCACAATTTCTATTT pLKO.1 4270 3UTR 100% 13.200 18.480 N MUCL3 n/a
2 TRCN0000083674 GCCTACGCTATACTCAGAGAA pLKO.1 3585 CDS 100% 4.950 6.930 N MUCL3 n/a
3 TRCN0000431119 ACACTGCACTGAGTCCTAAAG pLKO_005 4511 3UTR 100% 10.800 8.640 N MUCL3 n/a
4 TRCN0000083675 CCTCATTACATCTAGAACGAA pLKO.1 3855 CDS 100% 3.000 2.400 N MUCL3 n/a
5 TRCN0000083676 AGCCATCCATACCTCAATAAA pLKO.1 3913 CDS 100% 15.000 10.500 N MUCL3 n/a
6 TRCN0000418214 TACTACCTCTTCTCATCTAAA pLKO_005 3792 CDS 100% 13.200 9.240 N MUCL3 n/a
7 TRCN0000434427 TGGGTTTCAGGACAGCATTAT pLKO_005 4618 3UTR 100% 13.200 9.240 N MUCL3 n/a
8 TRCN0000083677 CAGTACAATGATGCAGAGGAT pLKO.1 4108 CDS 100% 2.640 1.848 N MUCL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13185 pDONR223 100% 16.8% 16.8% None 1_3474del n/a
2 ccsbBroad304_13185 pLX_304 0% 16.8% 16.8% V5 1_3474del n/a
3 TRCN0000470409 GTGATCGAATCAATGCCCACTCTA pLX_317 52.6% 16.8% 16.8% V5 1_3474del n/a
Download CSV