Transcript: Human NM_130385.3

Homo sapiens murine retrovirus integration site 1 homolog (MRVI1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
MRVI1 (10335)
Length:
6376
CDS:
387..3125

Additional Resources:

NCBI RefSeq record:
NM_130385.3
NBCI Gene record:
MRVI1 (10335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167667 GCTTAATGACTAACACCCTAA pLKO.1 3544 3UTR 100% 4.050 3.240 N MRVI1 n/a
2 TRCN0000168038 CCTTCACCAAGGAACTCTATT pLKO.1 3359 3UTR 100% 13.200 9.240 N MRVI1 n/a
3 TRCN0000168351 GAGCACATCCTGATGAGAAAT pLKO.1 1755 CDS 100% 13.200 9.240 N MRVI1 n/a
4 TRCN0000168488 GAAGAGTCAAAGAGTGGCTTA pLKO.1 1869 CDS 100% 4.050 2.835 N MRVI1 n/a
5 TRCN0000173035 CAGGAGTATCTTGCAGTCCAA pLKO.1 625 CDS 100% 2.640 1.848 N MRVI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02404 pDONR223 100% 65.4% 65.4% None 1_945del n/a
2 ccsbBroad304_02404 pLX_304 0% 65.4% 65.4% V5 1_945del n/a
Download CSV