Transcript: Human NM_130443.4

Homo sapiens dipeptidyl peptidase 3 (DPP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
DPP3 (10072)
Length:
2660
CDS:
41..2254

Additional Resources:

NCBI RefSeq record:
NM_130443.4
NBCI Gene record:
DPP3 (10072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050442 GCAGACGGAAGGCTTTAAGAA pLKO.1 1237 CDS 100% 5.625 7.875 N DPP3 n/a
2 TRCN0000050441 CGCGGGTGTTTACTCCAACAT pLKO.1 328 CDS 100% 4.950 6.930 N DPP3 n/a
3 TRCN0000220555 CTACGTGAACTGGCTCAACAT pLKO.1 1657 CDS 100% 4.950 6.930 N Dpp3 n/a
4 TRCN0000050438 CCCGAGGAGAATTTGAAGGTT pLKO.1 1011 CDS 100% 3.000 2.100 N DPP3 n/a
5 TRCN0000050439 GCATTCAACTTTGACCAGGAA pLKO.1 1442 CDS 100% 2.640 1.848 N DPP3 n/a
6 TRCN0000050440 CCACCTATTTCTCTGGGAATT pLKO.1 546 CDS 100% 0.000 0.000 N DPP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07545 pDONR223 100% 99.9% 100% None 1938A>G n/a
2 ccsbBroad304_07545 pLX_304 0% 99.9% 100% V5 1938A>G n/a
3 ccsbBroadEn_07546 pDONR223 100% 99.8% 99.8% None 227G>A;993C>T;1938A>G n/a
4 ccsbBroad304_07546 pLX_304 0% 99.8% 99.8% V5 227G>A;993C>T;1938A>G n/a
5 TRCN0000475438 CTTTAGCTGAGGCGGCCAGTGGTT pLX_317 22.2% 99.8% 99.8% V5 227G>A;993C>T;1938A>G n/a
Download CSV