Transcript: Mouse NM_130451.3

Mus musculus solute carrier family 2 (facilitated glucose transporter), member 10 (Slc2a10), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Slc2a10 (170441)
Length:
3434
CDS:
149..1759

Additional Resources:

NCBI RefSeq record:
NM_130451.3
NBCI Gene record:
Slc2a10 (170441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322431 ATGCGCTCTCATGGCCTTATC pLKO_005 1057 CDS 100% 10.800 15.120 N Slc2a10 n/a
2 TRCN0000322430 ATTACGCCTCTACCATCTTTC pLKO_005 903 CDS 100% 10.800 15.120 N Slc2a10 n/a
3 TRCN0000322501 CATAGGCAGCGCATCGGTATT pLKO_005 1703 CDS 100% 10.800 15.120 N Slc2a10 n/a
4 TRCN0000079415 GCTGTATCTACGTGTCAGAAT pLKO.1 504 CDS 100% 4.950 3.960 N Slc2a10 n/a
5 TRCN0000079417 TGCTGTATCTACGTGTCAGAA pLKO.1 503 CDS 100% 4.950 3.960 N Slc2a10 n/a
6 TRCN0000079414 GCTGAAATAGAGCAGCAGTTT pLKO.1 1652 CDS 100% 4.950 3.465 N Slc2a10 n/a
7 TRCN0000079416 GCTTTCATCTACCTACTTGTT pLKO.1 1607 CDS 100% 4.950 3.465 N Slc2a10 n/a
8 TRCN0000042839 GCTTGCTGTATCTACGTGTCA pLKO.1 500 CDS 100% 2.640 1.848 N SLC2A10 n/a
9 TRCN0000322500 CTGGGCAGCTAACCTCTTTAT pLKO_005 1501 CDS 100% 13.200 7.920 N Slc2a10 n/a
10 TRCN0000322432 TGAAACTCCTGATACAGATTT pLKO_005 1834 3UTR 100% 13.200 7.920 N Slc2a10 n/a
11 TRCN0000079413 CCCTGGTTTATTCATCTGCAA pLKO.1 2604 3UTR 100% 2.640 1.848 N Slc2a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.